circad | circRNAs associated with diseases

Hsa_circ_0067997
Gene	FNDC3B	Organism	Human
Genome Locus	chr3:172013152-172028671:+	Build	hg19
Disease	Gastric Cancer	ICD-10	Stomach, Malignant neoplasm of unspecified (C16.9)
DBLink	Link to database	PMID	30688097
Experimental Method
Sample Type	Tissue and cell lines	Comparison	48 pairs GC and corresponding non-cancer tissues
Method for Estimation	Quantitative PCR	PCR Details	Detailed Experimental Procedure
Primers (Experimented)	Forward AGCCAACAAGTCCCAAATTTG Reverse TGTGTCCAGGGGTTTGATCA	Statistics	Fold Change : Upregulated pvalue : p<0.05
Citation
Zhang, H, Wang, X, Huang, H, Wang, Y, Zhang, F, Wang, S (2019). Hsa_circ_0067997 promotes the progression of gastric cancer by inhibition of miR-515-5p and activation of X chromosome-linked inhibitor of apoptosis (XIAP). Artif Cells Nanomed Biotechnol, 47, 1:308-318.